Till KTH:s startsida Till KTH:s startsida

Gruppwebben som samarbetsyta stängs 1 oktober 2026. Då upphör redigeringsmöjligheterna. Du som administratör kan redan nu välja att exportera gruppens innehåll och radera gruppen.

Mer information och instruktioner hittar du i nyheten: Gruppwebben som samarbetsyta stängs 1 oktober 2026.

Random DNA sequences

Write a Python program that prints a random DNA sequence in Fasta format.

Requirements

Your program should ask for the length of the sequence and suggest a reasonable sequence name.

The session should look something like:

$ python randomdna.py
Length: 34

>myrandomsequence
TGCGCATATTGTCTAACTATGGCTGTGGCCGGA

The output must be in valid Fasta format.

To present:

  1. Your code and a test run.

Hints

To think about: What distribution do you want for the nucleotides?

The Python module random is suitable to use in this assignment. Take a look at the online documentation the random module! Which function do you find most useful for this assignment?